Journal: Cell metabolism

Article Title: CD38-NAD + Axis Regulates Immunotherapeutic Anti-Tumor T Cell Response

doi: 10.1016/j.cmet.2017.10.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Mycoplasma testing was done in Mehrotra lab. N/A Experimental Models: Organisms/Strains C57BL/6 Jackson Laboratory Stock# 000664 C57BL/6-Tg(HLA-A2.1)1Enge/J Jackson Laboratory Stock# 003475 B6.129S7- Rag1 tm1Mom /J Jackson Laboratory Stock# 002216 B6.129P2- Cd38 tm1Lnd /J Jackson Laboratory Stock# 003727 B6;129- Sirt1 tm1Ygu /J Jackson Laboratory Stock# 008041 Tg(Cd4-cre)1Cwi/BfluJ Jackson Laboratory Stock# 017336 B6.SJL- Ptprc a Pepc b /BoyJ Jackson Laboratory Stock# 002014 B6.129S7- Ifng tm1Ts /J Jackson Laboratory Stock# 002287 B6.Cg- Rag1 tm1Mom Tyrp1 B-w Tg(Tcra,Tcrb)9Rest/J Jackson Laboratory Stock# 008684 B6.Cg- Thy1 a /Cy Tg(TcraTcrb)8Rest/J Jackson Laboratory Stock# 005023 C57BL/6-Tg(TRAMP)8247Ng/J Jackson Laboratory Stock# 003135 IFNγ Thy1.1 knockin Casey T. Weaver, University of Alabama at Birmingham (UAB) ( Harrington et al., 2008 ) Foxo1 fl/fl Lck cre Melanie Gubbels Bupp, Randolph-Macon College, VA ( Gubbels Bupp et al., 2009) TCR-I Jennifer Wu, MUSC ( Staveley-O’Carroll et al., 2003) Oligonucleotides Primers for qPCR, see Table S4 Recombinant DNA MSGV1-TRP-1 vector ( Kerkar et al., 2011 ) N/A LV-TCR/sr39TK-GFP vector ( Koya et al., 2010 ) N/A Software and Algorithms FlowJo 10.2 TreeStar, OR https://www.flowjo.com/solutions/flowjo/downloads/ Prism 5 GraphPad https://www.graphpad.com/scientiflc-software/prism/ Agilent Seahorse Wave 2.4 Agilent http://www.agilent.com/en-us/products/cell-analysis-(seahorse )/seahorse-wave-software CFX Manager 3.1 Biorad http://www.bio-rad.com/en-us/sku/soft-cfx-31-patch-cfx-manager-software-v3-1-upgrade GenomeStudio software Illumina https://www.illumina.com/techniques/microarrays/array-data-analysis-experimental-design/genomestudio.html PIMENTo ( Sásik et al., 2004 ) https://github.com/MUSC-CGM/PIMENTo ToppGene Suite ( Chen et al., 2009 ) https://toppgene.cchmc.org/ Venny This paper http://bioinfogp.cnb.csic.es/tools/venny/index.html Open in a separate window KEY RESOURCES TABLE Th1/17 cells with effector and stemness features exhibit durable tumor control High glutaminolysis of Th1/17 cell regulates its viability and anti-tumor response NAD + -Sirt1-Foxo1 axis is central to the anti-tumor phenotype of Th1/17 cells Targeting NADase CD38 on T cells increases NAD + levels and controls tumor growth

Techniques: Recombinant, Staining, Cell Isolation, Synthesized, Lysis, Extraction, Cell Based Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Immunoprecipitation, cDNA Synthesis, SYBR Green Assay, Microarray, Knock-In, Plasmid Preparation, Software

Journal: Cell

Article Title: Homeostatic Control of Sebaceous Glands by Innate Lymphoid Cells Regulates Commensal Bacteria Equilibrium

doi: 10.1016/j.cell.2018.12.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Park (NCI/NIH) N/A Mouse: Tslp −/− Dr. S. Nakae (University of Tokyo) CDB0777K (RIKEN) Mouse: Il7 −/− Tslp −/− Dr. K. Moro (RIKEN) N/A Mouse: Tslpr −/− Dr. W. J. Leonard (NHLBI/NIH) N/A Mouse: B6.129S6- Ccr6 tm1(EGFP)Irw /J ( Ccr6 GFP/GFP ) Jackson Laboratory Stock No: 013061 Mouse: Tnf −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Lta −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Ltb −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Tnf −/− Lta − / − Ltb − / − Dr. D. Schlessigner (NIA/NIH) N/A Mouse: B6.FVB-Tg(Rorc-cre)1Litt/J (Rorc-Cre) Jackson Laboratory Stock No: 022791 Mouse: B6.129X1- Gt(ROSA)26Sor tm1(EYFP)Cos /J (ROSA-EYFP) Jackson Laboratory Stock No: 006148 Mouse: B6;SJL-Tg(Krt1–15-cre/PGR)22Cot/J Jackson Laboratory Stock No: 005249 Mouse: Adam10 tm1.1Khr (Adam10 flox ) Dr. K. Horiuchi (National Defense Medical College) N/A Software and Algorithms FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo Partek Flow Partek http://www.partek.com/partekflow Partek Genomics Suite Partek http://www.partek.com/pgs nSolver Analysis Software 4.0 NanoString Technologies https://www.nanostring.com/products/analysis-software/nsolver GraphPad Prism GraphPad Software https://www.graphpad.com/ Imaris Bitplane http://www.bitplane.com/ Seurat Satija Lab https://satijalab.org/seurat/ Open in a separate window KEY RESOURCES TABLE

Techniques: Purification, Virus, Isolation, Recombinant, Staining, Transfection, Electron Microscopy, dsDNA Assay, Software

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) IF staining of MM from the ileum of LysMRiboTag mice using anti-MHC II (green) and anti-hemagglutinin (HA, red) antibodies. White arrows indicate MHC II+ HA- macrophages. Scale bars = 50 μm. Images representative of n=2 mice per group. (B) Volcano plot of differential expression analysis (DEseq2) of TRAPseq from LysMAdrb2fl/+:RiboTag mice comparing input (ileum tissue) to immunoprecipitated (i.p.) transcripts (red dots) All i.p. samples indicated by red dots are log2FoldChange > 0.5 and padj > 0.05. Relevant macrophage genes highlighted in black text and Nlrp6 (neuronal specific) highlighted in blue text. (C) Transcripts per million (TPM) as calculated by Kallisto alignment of Adrb2 transcript comparing input (ileum tissue) or immunoprecipitated transcripts from LysMAdrb2fl/+:RiboTag and LysMΔAdrb2:RiboTag mice. (D-H) LysMΔAdrb2 and wild-type (WT) littermate control mice were orally infected with spiB. (D) Quantification of fecal colony forming units (CFU) on the indicated days post-infection (E) Quantification of fecal lipocalin-2 (Lcn-2) on the indicated days post-infection. (F) Total gastrointestinal transit time; experiments were ended at 450 min (dashed line); (G, H) Neuronal quantification in the ileum myenteric plexus on day 7 post-spiB infection of (G) LysMΔAdrb2 mice and WT littermates; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 mice and WT littermates (Figure S5B); (H) LysMΔAdrb2 and WT littermates receiving salbutamol via subcutaneous osmotic pumps and infected with spiB post-implantation; shaded area indicates mean day 7 iEAN numbers +/− SEM of non-infected LysMΔAdrb2 and WT littermate mice (Figure S5B). Unless indicated otherwise, data are representative of 3–6 mice per condition, were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S5 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Staining, Quantitative Proteomics, Immunoprecipitation, Control, Infection

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression